doi:10.1016/j.dnarep.2012.04.004

Article start

DNA Repair 11 (2012) 616– 623Contents lists available at SciVerse ScienceDirectDNA Repairj ourna l ho me pag e: www.elsevier.com/locate/dnarepairUnique mutational profile associated with a loss of TDG expression in the rectalcancer of a patient with a constitutional PMS2 deficiencyP. Vasovcaka,∗, A. Krepelovaa, M. Menigattib, A. Puchmajerovaa, P. Skapac, A. Augustinakovac,G. Amannd, A. Wernstedte, J. Jiricnyb, G. Marrab,1, K. Wimmere,1aDepartment of Biology and Medical Genetics, Charles University 2nd Faculty of Medicine and University Hospital Motol, V Uvalu 84, 15006 Prague 5, Czech RepublicbInstitute of Molecular Cancer Research of the University of Zurich, and the ETH Zurich, Winterthurerstrasse 190, CH-8057 Zurich, SwitzerlandcDepartment of Pathology and Molecular Medicine, Charles University 2nd Faculty of Medicine and University Hospital Motol, V Uvalu 84, 15006 Prague 5, Czech RepublicdDepartment of Pathology, Medical University of Vienna, Währinger Gürtel 18-20, 1090 Wien, AustriaeDivision of Human Genetics, Medical University Innsbruck, Schöpfstrasse 41, 6020 Innsbruck, Austriaa r t i c l e i n f oArticle history:Received 29 February 2012Received in revised form 21 April 2012Accepted 24 April 2012Available online 17 May 2012Keywords:TDGColorectal cancerCMMR-D syndromeMMR repairSupermutatora b s t r a c tCells with DNA repair defects have increased genomic instability and are more likely to acquire secondarymutations that bring about cellular transformation. We describe the frequency and spectrum of somaticmutations involving several tumor suppressor genes in the rectal carcinoma of a 13-year-old girl har-boring biallelic, germline mutations in the DNA mismatch repair gene PMS2. Apart from microsatelliteinstability, the tumor DNA contained a number of C:G → T:A or G:C → A:T transitions in CpG dinucleotides,which often result through spontaneous deamination of cytosine or 5-methylcytosine. Four DNA glyco-sylases, UNG2, SMUG1, MBD4 and TDG, are involved in the repair of these deamination events. Weidentified a heterozygous missense mutation in TDG, which was associated with TDG protein loss in thetumor. The CpGs mutated in this patient’s tumor are generally methylated in normal colonic mucosa.Thus, it is highly likely that loss of TDG contributed to the supermutator phenotype and that most of thepoint mutations were caused by deamination of 5-methylcytosine to thymine, which remained uncor-rected owing to the TDG deficiency. This case provides the first in vivo evidence of the key role of TDG inprotecting the human genome against the deleterious effects of 5-methylcytosine deamination.© 2012 Elsevier B.V. 1. IntroductionGenomic DNA is constantly exposed to endogenous and exoge-nous damaging agents. As failure to repair this damage leads tomutations, rearrangements and other deleterious events that cancause cellular malfunction, all living organisms have evolved effi-cient DNA repair pathways that safeguard their genomes. Twokey guardians of genomic integrity are mismatch repair (MMR)and base excision repair (BER). MMR addresses mismatches andsmall insertion/deletion loops that arise during replication and thatwould give rise to point- and frameshift mutations if left unre-paired. BER removes predominantly aberrant DNA bases arisingthrough hydrolysis and oxidation in non-replicating DNA.Malfunction of both MMR and BER are associated with can-cer. Heterozygous (monoallelic) germline mutations in the MMRgenes MSH2, MSH6, MLH1, and PMS2 are linked to the autosomal-dominant Lynch syndrome [1], which predisposes primarily to∗Corresponding author. Tel.: +420 224 433 521; fax: +420 224 433 520.E-mail address: pevas78@hotmail.com (P. Vasovcak).1G. Marra and K. Wimmer contributed equally.colorectal and endometrial cancers [2]. Lynch syndrome tumorslose the wild type MMR allele through somatic mutations orLOH. However, there are also rare cases of individuals with bial-lelic germline mutations in one of the MMR genes. These arereferred to as constitutional MMR-deficiency (CMMR-D) patients,who develop mainly childhood hematological malignancies and/orbrain tumors, as well as very early onset colorectal cancers. MostCMMR-D patients display also signs reminiscent of neurofibro-matosis type 1, such as café au lait spots [3].The hallmark of MMR-deficient colorectal cancers is microsatel-lite instability (MSI), which is manifested as an accumulation ofsomatic frameshift mutations in runs of mono- or dinucleotidesknown as microsatellites. In these tumors, frameshift mutationsare frequently found in the coding sequences of genes involved inthe control of growth regulation (TGFßRII, IGF2R, BAX) or DNA repair(MSH3, MSH6), the dysregulation of which promotes tumorigenesis.Frameshift mutations were described also in APC [4], a key tumorsuppressor gene in the Wnt signaling pathway, the malfunction ofwhich has been linked to the initiation of colorectal tumorigenesis[5].The link between BER deficiency and cancer is currently limitedto the autosomal-recessive MUTYH-associated polyposis syndrome1568-7864 © 2012 Elsevier B.V. http://dx.doi.org/10.1016/j.dnarep.2012.04.004Open access under CC BY-NC-ND license. Open access under CC BY-NC-ND license.

Vasovcak

P. Vasovcak et al. / DNA Repair 11 (2012) 616– 623617(MAP) [6,7]. In resting DNA, 8-oxoguanines (Go) are removed byOGG1, but failure to remove this aberrant base prior to replicationgives rise to Go/A mispairs. MUTYH glycosylase removes the mis-paired adenine and the repair polymerases insert a C opposite theGo, which provides OGG1 with a second chance at repair. Germlinemutations in MUTYH result in G → T transversion mutations, whichare a hallmark of MAP.To date, no cancer-associated mutations have been identified inother BER genes. This might seem unexpected, given that spon-taneous deamination of cytosine to uracil represents a frequentoccurrence. However, the removal of uracil from DNA can beaccomplished by at least four glycosylases: UNG2, SMUG1, MBD4or TDG [8]. With this degree of redundancy, inactivation of a singlegene would not be expected to have phenotypic consequences. Incontrast, deamination of 5-methylcytosine gives rise to T/G mis-pairs, which have been shown to be repaired by BER to C/G withthe help of MBD4 or TDG. We have been unable to detect MBD4activity in extracts of human 293T cells depleted of TDG [9] and itthus appears likely that the latter enzyme is principally responsiblefor the repair of 5-methylcytosine deamination.In this report, we describe a patient with biallelic germline PMS2mutations who developed a very early onset rectal cancer witha particular supermutator phenotype. Intriguingly, although theanalysis of the tumor DNA revealed MSI at noncoding and intronicrepeats, frameshift mutations were not detected in several ana-lyzed tumor suppressor genes. In contrast, an exceedingly highnumber of somatic C:G → T:A or G:C → A:T transitions were iden-tified in these genes, many in CpG dinucleotides.2. Material and methods2.1. Microsatellite instability (MSI) analysisFive quasi-monomorphic mononucleotide repeat markers, i.e.BAT-26, BAT-25, NR-21, NR-24, and MONO-27 were investigatedto assess MSI employing a fluorescence-based pentaplex-PCR assay(Ingenetix, Vienna, Austria) according to the manufacturer’s recom-mendations.2.2. Immunohistochemical analysis of mismatch repair proteinsand of the base excision repair protein TDGSections of formalin-fixed, paraffin-embedded tumors wereimmunostained with primary monoclonal antibodies against theMMR proteins MSH2 (Ab NA27, Calbiochem), MSH6 (Ab 610919,BD), MLH1 (Ab 551091, BD), and PMS2 (Ab 556415, BD), asdescribed previously [10]. An affinity-purified rabbit anti humanTDG antibody was kindly provided by Dr. P. Schär (Universityof Basel, Switzerland) and tissue immunostaining was performedusing the protocol described in [10]. This latter antibody wasdiluted 1:1500, and incubated with tissue sections overnight at4◦C.2.3. Mutation analysis in tumor tissueDNA was extracted from fresh frozen (−70◦C) colorectal tissuesusing Genomic DNA Purification Kit (Gentra Systems, Minneapolis,MI, USA) according to manufacturer’s recommendations. Somaticmutation analysis of the APC, KRAS, TP53, BRAF, CTNNB1, MUTYHgenes, as well as examination of MSI and MLH1 promoter hyper-methylation were performed as described previously [11]. TheMLH1 and MSH2 genes were pre-screened for mutations by dena-turing gradient gel electrophoresis (DGGE) as described in [12]and PCR fragments showing an aberrant DGGE profile were sub-sequently sequenced to determine the underlying mutation. TheMSH6 and NF1 genes were analyzed by direct sequencing of allexons amplified directly from tumor DNA using published primers[13,14]. Equally, the BER genes, UNG2, SMUG1, MBD4 and TDG, weresequenced directly from tumor DNA (primers for amplification ofBER genes are listed in Supplementary Table 1). All mutations foundin tumor DNA were analyzed also in DNA from the correspondingnormal mucosa to exclude their presence in the germline.Mutant allele-specific PCR amplification [15] was used to assesswhether two somatic stop mutations identified in APC exon 6 werelocated in trans or in cis. A forward primer (5′GTTTCTTGTTT-TATTTTAGT 3′) with the terminal 3′nucleotide specific for thefirst mutation (c.646C>T, p.R216*), and a reverse primer (5′CTAC-CTATTTTTATACCCAC 3′) positioned downstream of the secondmutation (c.694C>T, p.R232*), were used for PCR and subsequentsequencing of the generated PCR product.DNA from three additional CMMR-D patients (see Section 3) wasisolated from paraffin-embedded tumor tissue using Puregene Tis-sue Kit (Gentra Systems, Minneapolis, MI, USA) according to themanufacturer’s recommendations. For somatic mutation analysisin these tumors, APC (specified in Table 2) was amplified usingprimers published in [16], and CTNNB1 exon 3 was amplified withthe following primers: forward, 5′CAATCTACTAATGCTAATACT-GTTTCG 3′; reverse, 5′GTTCTCAAAACTGCATTCTGACTTTC 3′. Theresulting PCR products were sequenced in both directions.All cycle sequencing reactions were performed using the BigDyeTerminator v3.1 Cycle Sequencing kit (Applied Biosystems, Fos-ter City, CA, USA) according to manufacturer’s instructions, andsequences were analyzed with the 3130 Genetic Analyzer (AppliedBiosystem, Foster City, CA, USA).All mutations are described according to the recom-mendations of the Human Genome Variation Society(http://www.hgvs.org/mutnomen/). The TDG reference sequenceNM 003211.4 was from GenBank. The reference sequences usedfor the other analyzed genes are listed in Table 1.2.4. Bisulfite genomic sequencing analysisMethylation analysis of the TDG promoter (cancer tissue fromPatient 1) and of four CpG dinucleotides located in the APC exon 6and in the MLH1 exons 13 and 18 (cancer tissue from Patient 1 anda colonic mucosa sample from a control subject) was performedby bisulfite genomic sequencing. Sodium bisulfite conversion ofgenomic DNA was carried out with the EpiTect Bisulfite kit (Qia-gen, Hombrechtikon, Switzerland) according to the manufacturer’sinstructions. PCR products were cloned using the InsTAclone PCRCloning kit (Fermentas, St. Leon-Rot, Germany), and individualclones were subjected to sequencing. Primers used for the PCRreactions are listed in Supplementary Table 1.2.5. Germline PMS2 and NF1 mutation analysisBlood samples were obtained from the patient and her par-ents after they provided written informed consent. A previouslydescribed RNA-based mutation analysis protocol was used toidentify the germline mutations in PMS2 [17]. To confirm thepresence of an identified nonsense mutation at the genomiclevel, PMS2 exon 11 was amplified from genomic DNA withpublished primers [18] and subsequently sequenced. PMS2 multi-plex ligation-dependent probe amplification (MLPA) analysis wasused to confirm a multi-exon deletion. MLPA was performedwith SALSA kits P008-A1 and P008-B1 (MRC-Holland, Amsterdam,The Netherlands), according to the manufacturer’s instructionsusing a set of six reference DNA samples each containing twocopies of PMS2- and two copies of PMS2CL-specific sequences [19].The identified PMS2 germline mutations are described in accor-dance with the recommendations of the Human Genome Variation